Detail of EST/Unigene SRR546170.2459
Acc. SRR546170.2459
Internal Acc. G2HQ8GE01CTWFH_2
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=6e-22; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=8e-21; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=1e-18; Probable mannitol dehydrogenase OS=Medicago sativa E-value=2e-18; Mannitol dehydrogenase (Fragment) OS=Petroselinum crispum E-value=3e-18;
Length 184 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170;
Sequence TAAGGTCACAGTCATCAGTACCTCTCCGAACAAGAAGCAAGAAGCTATTGAACACCTTGG
TGCCGACTCATTTTTGGTCAGCCGTGACCAAGAACAGGTCCAGGCTGCCAATGGAACCAT
GGATGGTATTATTGACACAGTTTCTGCTGTTCATCCTCTATTGCCTTTAATTGGTCTTTT
GAAG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A