Detail of EST/Unigene SRR546170.20943
Acc. SRR546170.20943
Internal Acc. G2HQ8GE01BROC8_2
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=1e-16; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=9e-15; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=1e-13; Probable mannitol dehydrogenase OS=Medicago sativa E-value=2e-13; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=2e-13;
Length 156 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170;
Sequence CAAGGCTCTTGGGACTAAGGTCACAGTCATCAGTACCTCTCCGAACAAGAAGCAAGAAGC
TATTGAACACCTTGGTGCCGACTCATTTTTGGTCAGCCGTGACCAAGAACAGGTCCAGGC
TGCCAATGGAACCATGGATGGTATTATTGACACAGT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A