Detail of EST/Unigene SRR546170.163236
Acc. SRR546170.163236
Internal Acc. G2HQ8GE01B7A8R
Type EST
Annotation (Top 5 hits in Uniprot_trembl) unknown
Length 195 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170;
Sequence GATCGACATTGCAAACACAATGAAGCCAACTAGCTCTTATGATTAATATTTATACATATT
TGTTTCGATTTCTATAATATTACAGTGCTCAATGCTCAATTATGTGTGCGAATCATTGAA
ACAAAAGCTAGTTTATGTAAGGTGCCGTCATTTTGGTTTTTGGACTTTTCGTTGGTATTT
CGATAAACATAGAAT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A