Detail of EST/Unigene SRR546170.136528
Acc. SRR546170.136528
Internal Acc. G2HQ8GE01CU8QE
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=1e-35; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=1e-31; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=7e-31; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=9e-31; Cinnamyl alcohol dehydrogenase 8 OS=Arabidopsis thaliana E-value=3e-30;
Length 316 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170;
Sequence TTTCTCCGGAGCACCAACCATAACGAGCTTCCCATGAGGCTTCAAAAGACCAATTAAAGG
CAATAGAGGATGAACAGCAGAAACTGTGTCAATAATACCATCCATGGTTCCATTGGCAGC
CTGGACCTGTTCTTGGTCACGGCTGACCAAAAATGAGTCGGCACCAAGGTGTTCAATAGC
TTCTTGCTTCTTGTTCGGAGAGGTACTGATGACTGTGACCTTAGTCCCAAGAGCCTTGGC
AAATTTCACAGCGACATGGCCCAGCCCACCTAGACCAACGATCCCCACATGAAGACCAGG
CTTATCGAGTCCATAG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A