Detail of EST/Unigene SRR546170.131199
Acc. SRR546170.131199
Internal Acc. G2HQ8GE01AT834
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=4e-36; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=5e-32; Mannitol dehydrogenase (Fragment) OS=Petroselinum crispum E-value=2e-31; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=2e-31; Probable mannitol dehydrogenase 3 OS=Stylosanthes humilis E-value=3e-30;
Length 263 nt
Species Humulus lupulus
Belonged EST Libraries SRR546170;
Sequence ATCATTTCTTGTGTTTCTTTCATCCCTCCAATGGAACTTCCACCTACTATCTTTCTTCCC
AATATCAAAGAAAAAGCTGGCAGTTCAAGTGGTTTCTCCGGAGCACCAACCATAACGAGC
TTTCCATGAGGCTTCAAAAGACCAATTAAAGGCAATAGAGGATGAACAGCAGAAACTGTG
TCAATAATACCATCCATGGTTCCATTGGCAGCCTGGACCTGTTCTTGGTCACGGCTGACC
AAAAATGAGTCGGCACCAAGGTG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A