Detail of EST/Unigene SRR546168.91786
Acc. SRR546168.91786
Internal Acc. G2HQ8GE01BVXBH
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-32; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-29; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=5e-28; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=2e-26; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-25;
Length 220 nt
Species Humulus lupulus
Belonged EST Libraries SRR546168;
Sequence ATCAATGTCCTCAGCAAGCCTCTCAGACATAGAGTTCCTTGCCATCATTCTCATAATTAC
ATCATTGCTTTGAGCTGATGAGTCCATTAATGACCATGGCCCAATCTCAGACATTCCAAA
TGTTACTACCATCTGTTTGGCCAAACCGGTAATCTGTTGCAGATCACCAGCTGCACCTGT
TGTCACCTCAGGCTCGCCGAAGATAATTTCCTCTGCAGCT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A