Detail of EST/Unigene SRR546168.135586
Acc. SRR546168.135586
Internal Acc. G2HQ8GE01D8SWL
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-20; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=8e-17;
Length 232 nt
Species Humulus lupulus
Belonged EST Libraries SRR546168;
Sequence CACGGTTTGTTTTCTGATGTGGGTCAAAGCGATCTCATATGCTTCATCTGATAATCTCTT
GACAGCACTATCAATGTCCTCAGCAAAGCCTCTCAGACATAGAGTTCCTTGCCATCATTC
TCATAATTACATCATTGCTTTGAGCTGATGAGTCCAATTAATGACCATGGCCCAATCTCA
GACATTCCAAATGTTACTACCATCTGTTTGGCCAAACCGGTAATCTGTTGCA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A