Detail of EST/Unigene SRR546165.50053
Acc. SRR546165.50053
Internal Acc. G16PS2N02F7RBQ
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-36; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-33; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=1e-31; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=1e-28; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-26;
Length 297 nt
Species Humulus lupulus
Belonged EST Libraries SRR546165;
Sequence AATAAGGACTTCCACAATCTTGTCCATGGCCTCACGGTTGTTTCTGATGTGGGTCAAAGC
GATCTCATATGCTTCATCTGATAATCTCTTGACAGCACTATCAATGTCCTCAGCAAGCCT
CTCAGACATAGAGCTCCTTGCCATCATTCTCATAATTACATCATTGCTTTGAGCTGATGA
GTCCATTAATGACCATGGCCCAATCTCAGACATTCCAAATGTTACTACCATCTGTTTGGC
CAAACCGGTAATCTGTTGCAGATCACCAGCTGCACCTGTTGTCACCTCAGGCTCGCC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A