Detail of EST/Unigene SRR027942.166915
Acc. SRR027942.166915
Internal Acc. E580B0E02GR0YS
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Mannitol dehydrogenase OS=Apium graveolens E-value=3e-17; Mannitol dehydrogenase (Fragment) OS=Petroselinum crispum E-value=2e-15; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=7e-15; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=6e-14; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=8e-14;
Length 231 nt
Species Solanum pimpinellifolium
Belonged EST Libraries SRR027942;
Sequence TCAGAAGCAGTGGTATCAACGCAGAGTACGCGGGGACTCAAGAAATGTTAGATTTTGCAG
CAAAGCATAACATAACACCAGATGTTGAAGTCGTAGCAATGGACTACGTGAATACAGCGT
TGGAACGCCTTGTTAAAAACGATGTCAAGTATCGATTCGTGCTAGACATGGACAAGAAAA
TGAACACTGAGACACGCAACAGGGGATAGGCAAGGCACACAGGGGATAGGN
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A