Detail of EST/Unigene SRR015436.98069
Acc. SRR015436.98069
Internal Acc. ESXKO2301DQ6NT
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=1e-24; Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=2e-24; Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=8e-24; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=2e-13; Biotin carboxylase OS=Pseudomonas aeruginosa (strain ATCC 15692 / PAO1 / 1C / PRS 101 / LMG 12228) E-value=3e-13;
Length 242 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436;
Sequence TCAGCTGTTCGCGTGATCCGAACTGCCCATGAGATGGGAATTCCTTGTGTTGCGGTTTAT
TCGACCATTGATAAAGATGCCTTACATGTGAAGCTAGCTGATGAATCTGTTTGCATTGGA
GAAGCACCAAGTAATCAGTCGTATTTAGTGATCCCAAATGTCTTGTCTGCTGAAAATGTT
AGTGGATGACAAGCCAGATTATCTCTCTATTCGTTGTATGTTGGCTATTTTCCACTTGTT
AG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A