Detail of EST/Unigene SRR015436.79726
Acc. SRR015436.79726
Internal Acc. ESXKO2301CC6C8
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-32; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-31; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=5e-31; ATP-dependent zinc metalloprotease FtsH OS=Vaucheria litorea E-value=3e-26; ATP-dependent zinc metalloprotease FtsH OS=Porphyra purpurea E-value=3e-26;
Length 245 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436;
Sequence TCAGGCTGCTTCATTTAAGAGGTTAGCAAGATCTGCTCCACTGAAACCCGGTGTCCTCAT
GGCAATAACTTCAAGAGACACATCTGAATCAAACTTCTTGTTGCCGGCATGAACCTTTAA
GATCTCTGTTCTTCCCTTGATGTCTGGGACATCCACGGATACTTGTCTATCAAATCGTCC
TGGCCTCAGCAAAGCAGAGTCAAGAATATCTGCACGATTGGTTGCCGCAACAACTATTAT
ACCAG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A