Detail of EST/Unigene SRR015436.73959
Acc. SRR015436.73959
Internal Acc. ESXKO2301BYKC4
Type EST
Annotation (Top 5 hits in Uniprot_trembl) unknown
Length 278 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436;
Sequence TCAGATTTGTTGAAATTCCTGCTGAAAACCGCGTCCCTGCTGCTGTTCCTACCCCAGCAG
CTGTATAATAGCTTGAACATATACTGCAACTTGTACAATTCACATACACTTATCCCCCTA
ATTTGATCTAGAGTATAAACAATATATAGACTATAAGAAAGTTAAAAAACACTTTTGTAA
CAAAAAAAAAAGAAAAAAAACAAAACATGTCCGGCCGCCTCGGTCTCTACTCTGCGTTGA
TACCACTGCTTACTCTGCGTTGATACCACTGCTTACTC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A