Detail of EST/Unigene SRR015436.34396
Acc. SRR015436.34396
Internal Acc. ESXKO2301EHB4M
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=4e-31; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=3e-30; Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=4e-30; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=2e-21; 2-oxoglutarate carboxylase small subunit OS=Hydrogenobacter thermophilus (strain DSM 6534 / IAM 12695 / TK-6) E-value=1e-17;
Length 249 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436;
Sequence TCAGCTTAATCATCACGGGGTAACCAATCTCCTCGGCAAGCTTTACACCTTCTTCAGTAC
TCTGCAATAGTCCGTCACTTCCTGGTACAGTTGGAACACCAGCATTCTTCATTGTATCTC
TAGCAGTGGCTTTGTCACCCATGACTCTTATGCTGTCTGGATTTGGCCCAATAAAGTTGA
TTCCATGTTCTCTGCACATCTCAACAAAACCGCTACGAAAATTAGAGCTAACAGAACACT
CTCTGACAG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A