Detail of EST/Unigene SRR015436.318905
Acc. SRR015436.318905
Internal Acc. ESXKO2302GF9RP
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=3e-38; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=8e-38; Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=3e-37; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=6e-29; Biotin carboxylase 1 OS=Bacillus subtilis (strain 168) E-value=2e-24;
Length 249 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436;
Sequence TCAGGTTGCATCCTGGATATGGTTTCCTTTCTGAGAATGCAAGTTTTGTTGAGATGTGCA
GAGAACATGGAATCAACTTTATTGGGCCAAATCCAGACAGCATAAGAGTCATGGGTGACA
AAGCCACTGCTAGAGATACAATGAAGAATGCTGGTGTTCCAACTGTACCAGGAAGTGACG
GACTATTGCAGAGTACTGAAGAAGGTGTAAAGCTTGCCGAGGAGATTGGTTACCCCGTGA
TGATTAAGG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A