Detail of EST/Unigene SRR015436.307144
Acc. SRR015436.307144
Internal Acc. ESXKO2302G8QR1
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 40S ribosomal protein S8 OS=Prunus armeniaca E-value=5e-13; 40S ribosomal protein S8-2 OS=Arabidopsis thaliana E-value=5e-13; 40S ribosomal protein S8 OS=Oryza sativa subsp. japonica E-value=6e-13; 40S ribosomal protein S8 OS=Zea mays E-value=6e-13; 40S ribosomal protein S8-1 OS=Arabidopsis thaliana E-value=8e-13;
Length 256 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436;
Sequence TCAGGAATCCATTTCCTGATCAATGTAATCCGATTCCTGTCTTCCTGCAAGAACAATTAC
TACTCTGACAGAGAAATGAGAATGAATGAGGAGGTGGGTGTGCGGTAGATTTGAAGAATG
AGAAAGTATGAGCTTGGCAGACAGCCCGCAAACACAAAGCTGGTGCCAAATGCTAAGACT
GTTAGAAGGATAAGAGTCCGAGGAGGTAATGTGAAGTGGCGTGCTTTGAGGTTGGATACG
TGGGTAATTTCTTCGG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A