Detail of EST/Unigene SRR015436.298063
Acc. SRR015436.298063
Internal Acc. ESXKO2302IN4P7
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-32; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=8e-29; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=1e-28; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=2e-26; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-26;
Length 256 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436;
Sequence TCAGAAGCAACAACTCTTTGCTAGAATTGTTGGTGGACTTGGTGGAAGAGCTGCAGAAGA
AGTGATCTTTGGTGAACCTGAAGTGACCACTGGTGCTGCTGGTGATTTGCAGCAGATCAC
TGGTTTGGCAAAACAGATGGTTGTCACTTTTGGTATGTCTGAACTTGGCCCGTGGTCCCT
CATGGATTCTTCAGCCCAAAGTGGTGATGTAATCATGAGAAGGTTAAAGTTTTTTTCTGT
TTTCTATAATCAATAG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A