Detail of EST/Unigene SRR015436.272541
Acc. SRR015436.272541
Internal Acc. ESXKO2302IMTME
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=2e-38; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-38; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-38; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-34; ATP-dependent zinc metalloprotease FtsH OS=Guillardia theta E-value=4e-34;
Length 271 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436;
Sequence TCAGGAACCTGAAATTGAGAAAAATGGAACACCCGCTTCACCAGCAATTGCCTTTGCTAG
CAAGGTTTTCCCAGTACCAGGAGGACCAACAAGAAGAACACCTTTTGGAATACGAGCCCC
TACTGCAGTAAATCTCTCAGGTTTCTTCAAAAATTCTACGACCTCCATAAAATCTTGTTT
TGCTTCATCTACACCAGCAACATCATCAAATGTCACACCAGTGTTTGGCTCCATTTGAAT
TCTTGAAACTACCATATCAGCTAATGCCTAC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A