Detail of EST/Unigene SRR015436.272504
Acc. SRR015436.272504
Internal Acc. ESXKO2302H942E
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=4e-11; Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=8e-11; Biotin carboxylase, chloroplastic OS=Arabidopsis thaliana E-value=1e-09; Biotin carboxylase OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=2e-08; Propionyl-CoA carboxylase alpha chain, mitochondrial OS=Rattus norvegicus E-value=5e-07;
Length 268 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436;
Sequence TCAGTATCAATTCTCAAGGAACACGGAGTCTAACGTTGGTATGAAGTTGAGATAAAAAAG
GCAAGTGAAGACTATGACACCTCCACAGATGTAAATATAAAATCTATTGACAAACGTCCG
CCAAAACTTTCAACTCCTCCACCATCAGTGGAAGAAGAGAAGCAAGTGCATTCCACGTCC
ACCACCACCAGCTGTTGCCTTAATCATCACGGGGTAACCAATCTCCTCGGCAAGCTTTAC
ACCTTCTTCAGTACTCTGCAATAGTCCG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A