Detail of EST/Unigene SRR015436.253955
Acc. SRR015436.253955
Internal Acc. ESXKO2302GBR5A
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-30; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=7e-29; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-28; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=8e-24; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=9e-21;
Length 227 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436;
Sequence TCAGAATTTCAACAAATTCTGAGAGAATAGCACGGAATTCATCTCCAGTCATCGTCTCCT
TTTCAAGGAGGACTTCCACAATCTTATCAATTGCTTCACGGTTGCTGCGGATTTGGCTCA
ATGCAATCTCATATGCACTGTCTGAAAGCTTCTTCACAGCAACATCAATGTCTTCAGCTA
GCTTTTCTGACATCGAGTTCCTGGCCATCATTCTCATGATTACATCC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A