Detail of EST/Unigene SRR015436.229157
Acc. SRR015436.229157
Internal Acc. ESXKO2302FRHJ1
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=7e-20; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-20; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=7e-20; ATP-dependent zinc metalloprotease FtsH OS=Trichodesmium erythraeum (strain IMS101) E-value=1e-19; ATP-dependent zinc metalloprotease FtsH 1 OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=2e-19;
Length 264 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436;
Sequence TCAGTTTCCTCCTCCAATTCCAGTCCCTCTTTGCCGCCCAACAGCATCAATTTCATCAAC
AAATACAATGCAAGGAGCATTTTCCTTGGCCTTCTTGAAAAGATCACGGACTCGAGAGGC
TCCAACACCAACAAACATCTCAACGAATTCTGAACCTGAAATTGAGAAAAATGGAACACC
AGAGGCTCTTGATCTTCGTGGGAAGGCTGCAAATGCACAGGCTGCTCTAGCTTACGATCT
TTACCAAAAGAAATTTTCTGGTCC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A