Detail of EST/Unigene SRR015436.227141
Acc. SRR015436.227141
Internal Acc. ESXKO2302H8G2K
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-06;
Length 134 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436;
Sequence TCAGACGGTTGCTGCGGATTTGGCTCAATGCAATCTCATATGCACTGTCTGAAAGCTTCT
TCACAGCAACATCAATGTCTTCAGCTAGCCTGAGACACGCAACAGGGGATAGGCAAGGCA
CACAGGGGATAGGN
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A