Detail of EST/Unigene SRR015436.124047
Acc. SRR015436.124047
Internal Acc. ESXKO2301CYSTJ
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-36; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=5e-36; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=7e-36; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=4e-34; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-31;
Length 249 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436;
Sequence TCAGATCTGTGGAACTCTCACTCCAGGGCATGATGCTGTACAAAAGGTCACTCTAATCCC
ACGTGGTCAGGCAAAAGGTTTGACCTGGTTCATTCCTGCAGATGACCCAACCTTAATATC
CAAGCAACGACTCTTTGCTAGAATTGTTGGTGGACTTGGTGGAAGAGCTGCAGAAGAAGT
GATCTTTGGTGAACCTGAAGTGACCACTGGTGCTGCTGGTGATTTGCAGCAGATCACGTT
GGTTTACGG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A