Detail of EST/Unigene SRR015436.118741
Acc. SRR015436.118741
Internal Acc. ESXKO2301CL0MT
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-19; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=4e-19; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-18; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=3e-14; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-13;
Length 243 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015436;
Sequence TCAGCCAGCCACTATCCTATCAATTGAATCATCAATCTCTTTGGATGCGATTGCTGTCTT
ACCACGTCGACCTGCAAGAATGGCTGCTTCATTTAAGAGGTTAGCAAGATCTGCTCCACT
GAAACCCGGTGTCCTCATGGCAATAACTTCAAGAGACACATCTGAATCAAACTTCTTGTT
GCCGGNATGAACCTTTAAGATCTCTGTTCCTTCCCTTGATGTCGTGGGACATCCACGGAT
TAC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A