Detail of EST/Unigene SRR015435.56028
Acc. SRR015435.56028
Internal Acc. EIOURYN01EO8C7
Type EST
Annotation (Top 5 hits in Uniprot_trembl) unknown
Length 90 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGATGGCCAGGAACTTCGATGTCAGAAAAGCTAGCTGAAGACATTGATGTTGCTGTGA
AGAAGCTTTCAGACAGTGCATATGAGATTG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A