Detail of EST/Unigene SRR015435.355543
Acc. SRR015435.355543
Internal Acc. EIOURYN02JBJUD
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-06; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=4e-06;
Length 101 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGTGCATTGAGCCAAATTCCGCAGCAACCGTGAAGCAATTGATAAGATTGTGGAAGTC
CTCCTTGAAAAGGAGACGATGACTGGAGATGAATTCCGTGC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A