Detail of EST/Unigene SRR015435.32124
Acc. SRR015435.32124
Internal Acc. EIOURYN01AREWP
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=4e-12; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-12; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-11; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=4e-11; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-08;
Length 109 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGCTTCTGCAGCTCTTCCACCAAGTCCACCAACAATTCTAGCAAAGAGTTGTTGCTTG
GATATTAAGGTTGGGTCATCTGCAGGAATGAACCAGGTCAAACCTTTTG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A