Detail of EST/Unigene SRR015435.245989
Acc. SRR015435.245989
Internal Acc. EIOURYN02JA633
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-10; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=1e-10; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-10; ATP-dependent zinc metalloprotease FtsH OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=1e-10; ATP-dependent zinc metalloprotease FtsH OS=Guillardia theta E-value=1e-10;
Length 118 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGCCGCAACAACTATTATACCAGTATTTCCTTCGAACCATCCATTTCAGTCAATAGTT
GGTTCAGGGTCTGTTCCCTTTCATCATTTCCTCCTCCAATTCCAGTCCCTCTTTGCCG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A