Detail of EST/Unigene SRR015435.238512
Acc. SRR015435.238512
Internal Acc. EIOURYN02IMB2A
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FtsH OS=Tropheryma whipplei (strain Twist) E-value=9e-10; ATP-dependent zinc metalloprotease FtsH 3 OS=Symbiobacterium thermophilum (strain T / IAM 14863) E-value=9e-10; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-09; ATP-dependent zinc metalloprotease FtsH OS=Staphylococcus haemolyticus (strain JCSC1435) E-value=1e-09; ATP-dependent zinc metalloprotease FtsH OS=Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197) E-value=1e-09;
Length 123 nt
Species Solanum lycopersicum
Belonged EST Libraries SRR015435;
Sequence TCAGCTGAACCTGAAATTGAGAAAAATGGAACACCCGCTTCACCAGCAATTGCCTTTGCT
AGCAAGGTTTTCCCAGTACCAGGAGGACCAAACAAGAAGAACACCTTTTGGAATACGAGC
CCC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A