Detail of EST/Unigene GD250274
Acc. GD250274
Internal Acc. HLUTR3CH_T3_019_C08_27MAR2006_060
Type Singleton/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Pyrophosphate-energized membrane proton pump 2 OS=Arabidopsis thaliana E-value=0; Pyrophosphate-energized membrane proton pump 3 OS=Arabidopsis thaliana E-value=0; K(+)-insensitive pyrophosphate-energized proton pump OS=Moorella thermoacetica (strain ATCC 39073) E-value=9e-63; K(+)-insensitive pyrophosphate-energized proton pump OS=Thermoanaerobacter tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4) E-value=4e-56; K(+)-insensitive pyrophosphate-energized proton pump OS=Xanthomonas campestris pv. campestris (strain ATCC 33913 / NCPPB 528 / LMG 568) E-value=2e-47;
Length 770 nt
Species Humulus lupulus
Belonged EST Libraries HLUTR3CH (1 ESTs);
Sequence GTTTTGGAGCTTCTTTTGTTGCCCTGTTTGCACAGTTGGGAGGCGGAATATACACAAAAG
CAGCAGATGTTGGAGCAGACCTTGTTGGAAAAGTAGAGCAGGGCATTCCTGAAGATGATC
CTAGAAATCCTGCTGTGATTGCAGATCTGGGGGGAGACAATGTAGGCGATTGTGCAGCTA
GAGGTGCTGATCTATTTGAAAGTATCGCAGCTGAAATAATCAGTGCTATGATACTTGGGG
GAACAATGGCTAGACGTTGTAAAATTGAAGATCCAACTGGCTTCATATTGTTCCCTCTTG
TTGTTCACTCATTTGATCTTGTTATATCATCTGTTGGAATTTTCTCAATTAGGGGTACAC
GTGATTCTGGTGCGAAAGGTCCTATAGAAGATCCCATGGCAATTCTCCAAAAAGGATATT
CTATCACTATTGTGTTAGCTGTATTGACATTTGGCCTGTCTACTCGCTGGTTGCTTTACA
CTGAACAAGCACCTTCTGCATGGTTTAACTTTGCCTTATGTGGGCTAGTTGGTATCATCA
CAGCTTATGTTTTTGTCCGGATTACCAAGTATTACACTGACTACAAGCATGAACCTGTAC
GCTCTTTAGCTCTTTCTAGCTCCACGGGTCATGGGACAAATATAATTGCTGGTGTCAGTT
TGGGCCTGGAGTCAACTGCTCTTCCTGTTCTTGTTATTAGTGTAGCTATTATCTCAGCCT
TTTGGCTCGGTCAAACCTCTGGACTGGTAGATGAAACTGGAAAACCAACA
EST members of Unigene GD250274 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea); 3.A.10 H+-translocating diphosphatase H+-PPase
Probeset
Corresponding NCBI Gene 844231 
Trichome-related Gene from Literature 844231