Detail of EST/Unigene EX522905
Acc. EX522905
Internal Acc. ALF-R-08_2007-07-20_1/ALF(R)-8_P24_041_1
Type Singleton/Unigene
Annotation (Top 5 hits in Uniprot_trembl) S-adenosylmethionine synthase OS=Medicago truncatula E-value=4e-27; S-adenosylmethionine synthase OS=Brassica rapa subsp. pekinensis E-value=3e-26; S-adenosylmethionine synthase 5 OS=Brassica juncea E-value=3e-26; S-adenosylmethionine synthase 3 OS=Brassica juncea E-value=3e-26; S-adenosylmethionine synthase 1 OS=Brassica juncea E-value=3e-26;
Length 217 nt
Species Medicago sativa
Belonged EST Libraries MS_TRI2 (1 ESTs);
Sequence AAGCTGTGCGACCNGATCTCTGATGCAGTGCTCGACGCGTGTCTTGAGCAGGACCCTGAC
AGCAAGGTTGCCTGTGAGACATGCACCAAGACTAACATGGTCATGGTCTTTGGAGAAATA
ACAANNANGNCAACGTAGACTATGAGAAGATNGTTCGTGACACATGCCGCACCATTGGAT
TNATCTCTGATGATGTTGGTCTTGATGCCGACAAATG
EST members of Unigene EX522905 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00789 S-adenosylmethionine synthetase;
Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00789 S-adenosylmethionine synthetase
EC 2.5.1.6 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 826987 
Trichome-related Gene from Literature N/A