Detail of EST/Unigene EV257696
Acc. EV257696
Internal Acc. MTYDB49TF
Type Singleton/Unigene
Annotation (Top 5 hits in Uniprot_trembl) unknown
Length 674 nt
Species Medicago truncatula
Belonged EST Libraries MT_JCVI-MT1 (1 ESTs);
Sequence TAAACGTTCTTCTCCAACAATTATAGCTAACGGAACTTCCATTTCCAAGAAAAGAAAAAT
CACTGCTTCGCAGTTTCAGTCTTCTGAAATGAAGCATCAACTACCAAACTCGCTAGCTGA
AGCTGCAGAAAATATTCTTTCGTCGGCTTCCGACGAGTTTCGCTCGGACCACACTCCGCT
GTTGACTTGCTGCAGCTCCGGCAAGGTTACTGAAACCAACGACGTTAAGGAGCTCGACAC
TACACCGTTAGATCCAGAGCTGAAAACTAAGTGTTTTGAAACGGTAGACAAAACGAACCA
CAATTTAAAATCGTTCAGGGAGGCGGAGATTGATGAATTCTTTGCAAATTTTGAGAGGGA
AGAGCGGAAGAGATTTGCTGAGAAGTACAACTTTGATATTGTTAGAGACATGCCGTTGGA
GGGTCGTTATGAGTGGGTTCGTTTGCATTGAATGTCTTGAATGAGAGATAGAGAGAGTAG
TGGAAAAAAATTAGAGTGCGTGCATTTTTAGTTTTAGTGTCAGAGAGAGAGAGAGTTATG
GAGTGTGCTCAAGGGGAGAGTTAGTACTTACTTAGCAGAGATTATAGGTTTTCACGCATT
CAAGACATCGATAATCGTTTTAAATTCAAACTCAGCATTTTGAATGTGTGTTATCGATGT
TTCAATGCGTGAAA
EST members of Unigene EV257696 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset Mtr.16199.1.S1_at
Corresponding NCBI Gene 816875 
Trichome-related Gene from Literature 816875