Detail of EST/Unigene ES893661
Acc. ES893661
Internal Acc. LET065_2006-11-06_1/LET065_D03_013_1
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=3e-73; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-73; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-73; ATP-dependent zinc metalloprotease FtsH OS=Porphyra purpurea E-value=2e-63; ATP-dependent zinc metalloprotease FtsH OS=Porphyra yezoensis E-value=4e-63;
Length 527 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_TRI;
Sequence GAGAGGTTCAGAATTCGTTGAGATGTTTGTTGGTGTTGGAGCCTCTCGAGTCCGTGATCT
TTTCAAGAAGGCCAAGGAAAATGCTCCTTGCATTGTATTTGTTGATGAAATTGATGCTGT
TGGGCGGCAAAGAGGGACTGGAATTGGAGGAGGAAATGATGAAAGGGAACAGACCCTGAA
CCAACTATTGACTGAAATGGATGGTTTCGAAGGAAATACTGGTATAATAGTTGTTGCGGC
AACCAATCGTGCAGATATTCTTGACTCTGCTTTGCTGAGGCCAGGACGATTTGATAGACA
AGTATCCGTGGATGTCCCAGACATCAAGGGAAGAACAGAGATCTTAAAGGTTCATGCCGG
CAACAAGAAGTTTGATTCAGATGTGTCTCTTGAAGTTATTGCCATGAGGACACCGGGTTT
CAGTGGAGCAGATCTCGCTAACCTCTTAAATGAAGCAGCCATTCTTGCAGGTCGACGTGG
TAAGACAGCAATCGCATCCAAAGAGATTGATGATTCAATTGATAGGA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC 3.4.24.-  3.6.1.3 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 837154 
Trichome-related Gene from Literature N/A