Detail of EST/Unigene DB705378
Acc. DB705378
Internal Acc. DB705378
Type EST
Annotation (Top 5 hits in Uniprot_trembl) Biotin carboxylase 1, chloroplastic OS=Populus trichocarpa E-value=2e-10; Biotin carboxylase 2, chloroplastic OS=Populus trichocarpa E-value=4e-08;
Length 337 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_MicroLEAF3;
Sequence GTCTCAAGTTTTATTGCTTTCTTGTTTTCATCGACATCATCAACTTCCCATTCTTCAAAT
CTACCGCACACCCACCTCCTCATTCATTCTCATTTCTCTGTCAGAGTAGTAATTGTTCTT
GGCAGGAAGACAGGAATTGGATTACATTGATCAGGAAATGGATTCTGCAGCCATGACTAG
CGTTTGTGGCAAATCTGCTCTTTGCTCTACTCCCGGTTTATTTTTGGGGAGAACGAGCGG
TATTAGGAGCTCGCAGTGTAGCTTTATAGCTGGAAATAGGATAAACTTTCCAAGGCAGAC
AGCTCAAGCACACAGAGTTCGTACTAATTCTCGCAAG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A