Detail of EST/Unigene CO517249
Acc. CO517249
Internal Acc. s13dSG32E1200099_486094
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase OS=Mesembryanthemum crystallinum E-value=6e-38; 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase OS=Solenostemon scutellarioides E-value=3e-37; 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase OS=Arabidopsis thaliana E-value=3e-37; 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase OS=Catharanthus roseus E-value=8e-37; 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase OS=Cytophaga hutchinsonii (strain ATCC 33406 / NCIMB 9469) E-value=3e-21;
Length 510 nt
Species Medicago sativa
Belonged EST Libraries MS_TRI1;
Sequence GCACAAAACTGGAAAATTGCAATATCAATAAAGATTGTGGCAGAGCCACGGATACAGAGA
CATTTGGAAAAACAGAAAAGTGGGGTAAAATGAAATTTTGGGAGGGGGGATTAATTTGCT
CACAGAGCATACTAAATACCTAAATATTGCACACAGTTATTGAAACATCCAAAATAGAAA
ATTATCCTCTTGTGTAAATCAAACAGATTCAATATCACTGCTGAGATTCTCTTTCCTTCA
ACCTTTTCACTTGGCAAGCTCGTTACGGATTTGTTTGGCTGCAGCAACCATGTTGAGGAG
GGCAGGCTTAACCTCTGTGTACTTACGGGTTTTTAGCCCACAGTCAGGGTTGACCCACAA
AACGTTCTTCTCAAGGACAGCAAGCATCTTGTTGATCCTGTCGGCGATCTCGTCAGTTGG
TGGGATTCTTGGGGAGTGGATGTCATACACACCAGGGCCAATTCCAGCACCATAAACAAC
TCCTTCACGGAAGACTGATAGAAGCTTTTC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 831660 
Trichome-related Gene from Literature N/A