Detail of EST/Unigene CO516849
Acc. CO516849
Internal Acc. s13dSG98E0400024_447026
Type Singleton/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Aspartate aminotransferase, mitochondrial OS=Arabidopsis thaliana E-value=5e-63; Aspartate aminotransferase, mitochondrial OS=Homo sapiens E-value=5e-43; Aspartate aminotransferase, mitochondrial OS=Mus musculus E-value=2e-42; Aspartate aminotransferase, mitochondrial OS=Pongo abelii E-value=3e-42; Aspartate aminotransferase, mitochondrial OS=Macaca fascicularis E-value=3e-42;
Length 445 nt
Species Medicago sativa
Belonged EST Libraries MS_TRI1 (1 ESTs);
Sequence GGGCAGAAGAACAATGGAGAGAGATCTCTTCTCAAATGAAGGCTAAAGGTCATTTCCCTT
TGTTTGACATGGCATACCAAGGTTTTGCTAGTGGAAATCCAGATAGAGATGTAAAAGCCA
TCAGGATTTTTGTTGATGATGGTCATTTATTAGGACTTGCTCAATCATATGCAAAAAATA
TGGGACTGTATGGCCAGAGAGTTGGATGCCTTAGCTTACTTTGCGAAAATGAGAAACAAG
CCGTGGCTGTAAAAAGTCAATTGCAATTGATTTCCAGACCCATGTACAGCAATCCACCTC
TTCATGGAGCACTTGTCGTTTCAACTGTCCTTGGTGATCCAGACTTGAAGAAGTTGTGGC
TTANAGAAGTCAAGGTTATGGCAGACCGCATCATTGGAATGAGAACTACACTACGAGAGA
ATTTGGAAAATCTGGGGTCTCCATT
EST members of Unigene CO516849 
InterProScan Domain  
Gene Ontology  
KEGG Orthology Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00813 aspartate aminotransferase;
Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00813 aspartate aminotransferase;
Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00813 aspartate aminotransferase;
Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00813 aspartate aminotransferase;
Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K00813 aspartate aminotransferase;
Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K00813 aspartate aminotransferase;
Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00813 aspartate aminotransferase;
Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00813 aspartate aminotransferase;
Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan b
EC 2.6.1.1 
Transcription Factor Family
Transporter Classification Family
Probeset Msa.1529.1.S1_at
Corresponding NCBI Gene 817648 
Trichome-related Gene from Literature N/A