Detail of EST/Unigene CO514918
Acc. CO514918
Internal Acc. s13dSG63A0500037_397341
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase OS=Mesembryanthemum crystallinum E-value=2e-31; 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase OS=Solenostemon scutellarioides E-value=9e-31; 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase OS=Arabidopsis thaliana E-value=9e-31; 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase OS=Catharanthus roseus E-value=3e-30; 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase OS=Cytophaga hutchinsonii (strain ATCC 33406 / NCIMB 9469) E-value=3e-21;
Length 472 nt
Species Medicago sativa
Belonged EST Libraries MS_TRI1;
Sequence GGGGTGCTGGAATTGGCCCTGGTGTGTATGACATCCACTCCCCAAGAATCCCACCAACTG
ACGAGATCGCCGACAGGATCAACAAGATGCTTGCTGTCCTTGAGAAGAACGTTTTGTGGG
TCAACCCTGACTGTGGGCTGAAAACCCGTAAGTACACAGAGGTTAAGCCTGCCCTCCTCA
ACATGGTTGCTGCAGCCAAACAAATCCGTAACGAGCTTGCCAAGTGAAAAGGTTGAAGGA
AAGAGAATCTCAGCAGTGATATTGAATCTGTTTGATTTACACAAAAGGATAATTTTCTAC
TTTGGATGTTTCAATAACTGTGTGCAATATTTAGGTATTTAGTATGCTCTGTGAGCAAAT
TAATCCCCCCTCCCAAAATTTCATTTTACCCCACTTTTCTGTTTTTCCAAATGTCTCTGT
ATCCGTGGCTCTGCCACAATCTTTATTGATATTGCAATTTTCCAGTTTTGTG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 831660 
Trichome-related Gene from Literature N/A