Detail of EST/Unigene CO514842
Acc. CO514842
Internal Acc. s13dSG56A0100005_328344
Type EST
Annotation (Top 5 hits in Uniprot_trembl) unknown
Length 281 nt
Species Medicago sativa
Belonged EST Libraries MS_TRI1;
Sequence TAAACAAATGAAAGACTTTCAAAAGATTTCATCCAATTAAAATTTTCATAATGACTGGGT
TGACTTTGAAAATGCATTCATTGAAATTGAATTGGTTGGGTGGTACCAAGAAAATCGATT
ATTAACTTACATTTCTTATTAACTATTAATTAATATTAAATATTAATTAAATTAACTGAT
CAACTTGCTTTGTTATCAAACATTTTTTTCTTGATTTCAATTTTTTTTTTTTTCAGAAAA
AAAAAAAAAACGGATATATTTTAATATGAGACTAACTCCTA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A