Detail of EST/Unigene BQ158704
Acc. BQ158704
Internal Acc. NF067C03PL1F1020
Type EST
Annotation (Top 5 hits in Uniprot_trembl) unknown
Length 112 nt
Species Medicago truncatula
Belonged EST Libraries MT_PhoLEAF;
Sequence CGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGC
GGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACCAGCT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A