Detail of EST/Unigene BP909755
Acc. BP909755
Internal Acc. BP909755
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-73; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=1e-72; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-71; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=4e-64; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-60;
Length 479 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_Lyc_leaf;
Sequence GTGTCTCTTGAAGTTATTGCCATGAGGACACCGGGTTTCAGTGGAGCAGATCTTGCTAAC
CTCTTAAATGAAGCAGCCATTCTTGCAGGTCGACGTGGTAAGACAGCAATCGCATCCAAA
GAGATTGATGATTCAATTGATAGGATAGTGGCTGGTATGGAAGGAACAGTCATGACTGAT
GGCAAGAGCAAGAGTCTGGTGGCATATCACGAAGTTGGACATGCCATCTGTGGAACTCTC
ACTCCAGGGCATGATGCTGTACAAAAGGTCACTCTAATCCCACGTGGTCAGGCAAAAGGT
TTGACCTGGTTCATTCCTGCAGATGACCCAACCTTAATATCCAAGCAACAACTCTTTGCT
AGAATTGTTGGTGGACTTGGTGGAAGAGCTGCAGAAGAAGTGATCTTTGGTGAACCTGAA
GTGACCACTGGTGCTGCTGGTGATTTGCAGCAGATCACTGGTTTGGCAAAACAGATGGT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC 3.4.24.- 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 837154 
Trichome-related Gene from Literature N/A