Detail of EST/Unigene BP904452
Acc. BP904452
Internal Acc. BP904452
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-26; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=1e-24; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-24; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=2e-18; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-16;
Length 381 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_Lyc_leaf;
Sequence TGTCAGAAAAGCTAGCTGAAGACATTGATGTTGCTGTGAAGAAGCTTTCAGACAGTGCAT
ATGAGATTGCATTGAGCCAAATCCGCAGCAACCGTGAAGCAATTGATAAGATTGTGGAAG
TCCTCCTTGAAAAGGAGACGATGACTGGAGATGAATTCCGTGCTATTCTCTCAGAATTTG
TTGAAATTCCTGCTGAAAACCGCGTCCCTGCTGCTGTTCCTACCCCAGCAGCTGTATAAT
AGCTTGAACATATACTGCAACTTGTACAATTCACATACACTTATCCCCCTAATTTGATCT
AGAGTATAAACAATATATAGACTATAAGAAAGTTAAAAAACACTTTTGTGCATTTGTGTA
TGAAGCAAATTTTCACATTTG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 837154 
Trichome-related Gene from Literature N/A