Detail of EST/Unigene BP880380
Acc. BP880380
Internal Acc. BP880380
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=9e-78; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-77; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-77; ATP-dependent zinc metalloprotease FtsH OS=Guillardia theta E-value=4e-74; ATP-dependent zinc metalloprotease FtsH OS=Porphyra purpurea E-value=2e-73;
Length 486 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_maturing_fruit;
Sequence AGATTTACTGCAGTAGGGGCTCGTATTCCAAAAGGTGTTCTTCTTGTTGGTCCTCCTGGT
ACTGGGAAAACCTTGCTAGCAAAGGCAATTGCTGGTGAAGCGGGTGTTCCATTTTTCTCA
ATTTCAGGTTCAGAATTCGTTGAGATGTTTGTTGGTGTTGGAGCCTCTCGAGTCCGTGAT
CTTTTCAAGAAGGCCAAGGAAAATGCTCCTTGCATTGTATTTGTTGATGAAATTGATGCT
GTTGGGCGGCAAAGAGGGACTGGAATTGGAGGAGGAAATGATGAAAGGGAACAGACCCTG
AACCAACTATTGACTGAAATGGATGGTTTCGAAGGAAATACTGGTATAATAGTTGTTGCG
GCAACCAATCGTGCAGATATTCTTGACTCTGCTTTGCTGAGGCCAGGACGATTTGATAGA
CAAGTATCCGTGGATGTCCCAGACATCAAGGGAAGAACAGAGATCTTAAAGGTTCATGCC
GGCAAC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC 3.4.24.-  3.6.1.3 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 837154 
Trichome-related Gene from Literature N/A