Detail of EST/Unigene BP132836
Acc. BP132836
Internal Acc. BP132836
Type Singleton/Unigene
Annotation (Top 5 hits in Uniprot_trembl) unknown
Length 543 nt
Species Nicotiana tabacum
Belonged EST Libraries NT_MAT001 (1 ESTs);
Sequence GTTCTCTATTCGACCTTTTATTGATTTCACATAACTGGCTGGACTAGAGGGGATTTCAGA
AGCCCAGAGTAATAACTTTACATAATCCTCTAGTGAGCTTGAAATCCTTGAAAGAATAGA
ATGGCCCCAGCAGATGGAATAAATACAGAAAGACCAACTAAAAACAAATGAGCAATTCTT
GGATCTGGGAGCTTCACTACTATCTTCTCAATCTACTCTCTGTTCTCCTTGATTTTGCAC
ACTCCCCAAACCATAAGAACCGCCCGCCTTTAGGTGGATGCACGGGGGTCCCTTGTTTGA
CCTTCCCCCTTCTATGGGGTCTGGTGTTGTTCCAACAGAAACAACTTCCAGCACCAGATC
CTGATTCATATCCCATGCTCTCCTTGCTGAAATTGCCGGCATAGATGCCATTATGCAACA
AACTTGGTGAAATGGGATAATTGTCGCCCTTTTTACTGGTCTGATCCTTCTGAATGGTCT
TTCCATCAATCATCTTCAGACTTCTTATTTCTTCATTTAGATCATCATGCCAATGCTGGG
AGG
EST members of Unigene BP132836 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 814777 
Trichome-related Gene from Literature 814777