Detail of EST/Unigene BG628806
Acc. BG628806
Internal Acc. cC-esflcLEL23L11d1
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-14; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=1e-13; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=9e-12; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=1e-09; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-08;
Length 333 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_FLOWER_DEV;
Sequence ACAGNGAAGAAAAGACTAGTTCTATATCAAATGTGAAAATTTGCTTCATACACAAATGCA
CAAAAGTGTTTTTTAACTTTCTTATAGTCTATATATTGTTTATACTCTAGATCAAATTAG
GGGGATAAGTGTATGTGAATTGTACAAGTTGCAGTATATGTTCAAGCTATTATACAGCTG
CTGGGGTAGGAACAGCAGCAGGGACGCGGTTTTCAGCAGGAATTTCAACAAATTCTGAGA
GAATAGCACGGAATTCATCTCCAGTCATCGTCTCCTTTTCAAGGAGGACTTCCACAATCT
TATCAATTGCTTCACGGTTGCTGCGGATTTGGC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 837154 
Trichome-related Gene from Literature N/A