Detail of EST/Unigene BF098202
Acc. BF098202
Internal Acc. EST428811
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-96; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=2e-93; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=4e-92; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=6e-82; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-78;
Length 609 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_DEF_ROOT;
Sequence TCTCTTGAAGTTATTGCCATGAGGACACCGGGTTTCAGTGGAGCAGATCTTGCTAACCTC
TTAAATGAAGCAGCCATTCTTGCAGGTCGACGTGGTAAGACAGCAATCGCATCCAAAGAG
ATTGATGATTCAATTGATAGGATAGTGGCTGGTATGGAAGGAACAGTCATGACTGATGGC
AAGAGCAAGAGTCTGGTGGCATATCACGAAGTTGGACATGCCATCTGTGGAACTCTCACT
CCAGGGCATGATGCTGTACAAAAGGTCACTCTAATCCCACGTGGTCAGGCAAAAGGTTTG
ACCTGGTTCATTCCTGCAGATGACCCAACCTTAATATCCAAGCAACAACTCTTTGCTAGA
ATTGTTGGTGGACTTGGTGGAAGAGCTGCAGAAGAAGTGATCTTTGGTGAACCTGAAGTG
ACCACTGGTGCTGCTGGTGATTTGCAGCAGATCACTGGTTTGGCAAAACAGATGGTTGTC
ACTTTTGGTATGTCTGAACTTGGCCCGTGGTCCCTCATGGATTCTTCAGCCCAAAGTGGT
GATGTAATCATGAGAATGATGGCCAGGAACTCGATGTCAGAAAAGCTAGCTGAAGACATT
GATGTTGCT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC 3.4.24.- 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 837154 
Trichome-related Gene from Literature N/A