Detail of EST/Unigene AW220814
Acc. AW220814
Internal Acc. EST297283
Type EST
Annotation (Top 5 hits in Uniprot_trembl) unknown
Length 522 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_PRERIP_FRUIT_TAMU;
Sequence TTTAAAGTTGAAAATATTTTTAAAAAGCATAATTAATTTTTTGGGGAGGGGGTGGGGCTG
AAAGACAGAAAAATTCCATGGCAGTAGATATTTGAAGTATCAGCACATATAAAATCTAAT
CTATCATGCATAACAGAAACATTAGGCCGAAGCATGTCCCTACTTGCATTTCTTTTTGCA
TATGGGACAAAATACTCGATACATGTAGAACTGTAAGGTGCAGCTACAACAACTCATATC
TTTAATCAATCATATTTGCCGGAATACGAGATAAAACATATTTTCACAGGAAGGGTTGTG
AAGTAGGTGCTTTGCGCTTTACTTTTTTTGGGATTGCAGATGTGCAAGGTACTTTCTGAC
TCTGGTGAAGATTCATTTAATGCAGTAGCACGTCAGCCAGCTAGTCTGGCGTTAAAAAGG
AACCTCCTTACACTGGAGGCCTTTATACAAGAGATGAACCGAGTACTTTCTTTCGCGCAT
CAGAATCCTGTTCATGCTCCAGGGAGTGAACTTACAAGAAGA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene N/A
Trichome-related Gene from Literature N/A