Detail of EST/Unigene AW092275
Acc. AW092275
Internal Acc. EST285455
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-46; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=4e-43; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-42; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=2e-33; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-31;
Length 520 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_CELL_BTI;
Sequence GCAAAACAGATGGTTGTCACTTTTGGTATGTCTGAACTTGGCCCGTGGTCCCTCATGGAT
TCTTCAGCCCAAAGTGGTGATGTAATCATGAGAATGATGGCCAGGAACTCGATGTCAGAA
AAGCTAGCTGAAGACATTGATGTTGCTGTGAAGAAGCTTTCAGACAGTGCATATGAGATT
GCATTGAGCCAAATCCGCAGCAACCGTGAAGCAATTGATAAGATTGTGGAAGTCCTCCTT
GAAAAGGAGACGATGACTGGAGATGAATTCCGTGCTATTCTCTCAGAATTTGTTGAAATT
CCTGCTGAAAACCGCGTCCCTGCTGCTGTTCCTACCCCAGCAGCTGTATAATAGCTGGAA
CATATACTGCAACTTGTACAATTCACATACACTTATCCCCCTAATTTGATCTAGAGTATA
AACAATATATAGACTATAAGAAAGTTAAAAAACACCTTTGTGCATTTGTGTATGAAGCAA
ATTTTCACATTTGATATAGAACTAGTCTTTTCTTCACTGT
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 837154 
Trichome-related Gene from Literature N/A