Detail of EST/Unigene AW040697
Acc. AW040697
Internal Acc. EST283561
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=5e-98; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=7e-98; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-97; ATP-dependent zinc metalloprotease FtsH OS=Guillardia theta E-value=7e-90; ATP-dependent zinc metalloprotease FtsH OS=Porphyra purpurea E-value=8e-88;
Length 590 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_CELL_BTI;
Sequence TCCAAATGGAGCCAAACACTGGTGTGACATTTGATGATGTTGCTGGTGTAGATGAAGCAA
AACAAGATTTTATGGAGGTCGTAGAATTTTTGAAGAAACCTGAGAGATTTACTGCAGTAG
GGGCTCGTATTCCAAAAGGTGTTCTTCTTGTTGGTCCTCCTGGTACTGGGAAAACCTTGC
TAGCAAAGGCAATTGCTGGTGAAGCGGGTGTTCCATTTTTCTCAATTTCAGGTTCAGAAT
TCGTTGAGATGTTTGTTGGTGTTGGAGCCTCTCGAGTCCGTGATCTTTTCAAGAAGGCCA
AGGAAAATGCTCCTTGCATTGTATTTGTTGATGAAATTGATGCTGTTGGGCGGCAAAGAG
GGACTGGAATTGGAGGAGGAAATGATGAAAGGGAACAGACCCTGAACCAACTATTGACTG
AAATGGATGGTTTCGAAGGAAATACTGGTATAATAGTTGTTGCGGCAACCAATCGTGCAG
ATATTCTTGACTCTGCTTTGCTGAGGCCAGGACGATTTGATAGACAAGTATCCGTGGATG
TCCCAGACATCAAGGGAAGAACAGAGATCTTAAAGGTTCATGCCGGCAAC
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC 3.4.24.-  3.6.1.3 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 837154 
Trichome-related Gene from Literature N/A