Detail of EST/Unigene AW035651
Acc. AW035651
Internal Acc. EST281483
Type EST
Annotation (Top 5 hits in Uniprot_trembl) ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=6e-88; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-79;
Length 628 nt
Species Solanum lycopersicum
Belonged EST Libraries SL_TAMU_CALLUS;
Sequence CTGGAATTGGAGGAGGAAATGATGAAAGGGAACAGACCCTGAACCAACTATTGACTGAAA
TGGATGGTTTCGAAGGAAATACTGGTATAATAGTTGTTGCGGCAACCAATCGTGCAGATA
TTCTTGACTCTGCTTTGCTGAGGCCAGGACGATTTGATAGACAAGTATCCGTGGATGTCC
CAGACATCAAGGGAAGAACAGAGATCTTAAAGGTTCATGCCGGCAACAAGAAGTTTGATT
CAGATGTGTCTCTTGAAGTTATTGCCATGAGGACACCGGGTTTCAGTGGAGCAGATCTTG
CTAACCTCTTAAATGAAGCAGCCATTCTTGCAGGTCGACGTGGTAAGACAGCAATCGCAT
CCAAAGAGATTGATGATTCAATTGATAGGATAGTGGCTGGTATGGAAGGAACAGTCATGA
CTGATGGCAAGAGCAAGAGTCTGGTGGCATATCACGAAGTTGGACATGCCATCTGTGGAA
CTCTCACTCCAGGGCATGATGCTGTACAAAAGGTCACTCTAATCCCACGTGGTCAGGCAA
AAGGTTTGACCTGGTTCATTCCTGCAGATGACCCAACCTTAATATCCAAGCAACAACTCT
TTGCTAGAATTGTTGGTGGACTTGGTGG
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC 3.4.24.-  3.6.1.3 
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 837154 
Trichome-related Gene from Literature N/A