Detail of EST/Unigene AM815950
Acc. AM815950
Internal Acc. AM815950
Type Singleton/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Pyrophosphate-energized membrane proton pump 2 OS=Arabidopsis thaliana E-value=5e-08; Pyrophosphate-energized membrane proton pump 3 OS=Arabidopsis thaliana E-value=1e-07;
Length 436 nt
Species Nicotiana tabacum
Belonged EST Libraries NT_DL (1 ESTs);
Sequence ATCTGGTAGGAGACGATGTTGGTGACTGTGCTGCTCGAAGTGCAGATCTTTTCGAAAGTA
TTGCCGCGGAGATTATTAGTGCAATGATACTTGGAGGAACCATGGCTAAGCACTGCAAAA
TTGAAGGTAGCTTGACGCTCACACTCACACTTGAGTTGATTTAATTTAACTTAAGTAGCT
ACAGAAATTTGGTTCTGAAGGTGAGTGGTAATCTTGGTGGGAATGTATCAAAAAGACGAA
TGTAATATGCCGACCCTTGCACTTGAATCCAAATATTATGAAACAGGGAATTTTGTAACA
TAGGCGTGGGTACTGTGAGGATGAAACTGCTAATGTTTGCAAATGAGAGACATCAAGTGT
TTGTAGATCAGTGCTGTACAACCCAAAAAGCCCCAAAAGCGCTGAAGTCAGTGAAGTTAT
AGGTGTTTGAGAGCAA
EST members of Unigene AM815950 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC
Transcription Factor Family
Transporter Classification Family 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea); 3.A.10 H+-translocating diphosphatase H+-PPase
Probeset
Corresponding NCBI Gene 844231 
Trichome-related Gene from Literature 844231